View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_low_44 (Length: 250)
Name: NF10151_low_44
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 19784638 - 19784803
Alignment:
| Q |
1 |
atataattttggcggactctaactagggttattggctgcaagaggccacctttaaagtgtaaagccagaaaaatatttagatttactgccgattttggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19784638 |
atataattttggcggactctaactagggttattggctgcaagaggccacctttaaagtgtaaagccagaaaaatatttagatttactgccagttttggcc |
19784737 |
T |
 |
| Q |
101 |
acatgtaatggacaaatgagtgttggataataccgatgacctctgatgacaggccatcttacgttc |
166 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
19784738 |
acatgtaatggccaaatgagtgttggatagtaccaatggtctctgatgacaggccatcttacgttc |
19784803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 19784840 - 19784876
Alignment:
| Q |
203 |
acaagcaaaatagaggagtataagagcaattgcctat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19784840 |
acaagcaaaatagaggagtataagagcaattgcctat |
19784876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University