View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_low_54 (Length: 238)
Name: NF10151_low_54
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 19784640 - 19784451
Alignment:
| Q |
1 |
tatttttccattctaacattttttcttgagtcatgtacacattttggattccaacttattgcaggnnnnnnn---ctgtcatga-ttacttgggtctcat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
19784640 |
tatttttccattctaacattttttcttgagtcatgtacacattttggattccaacttattgcaggttttttttttctgtcatgaattacttgggtctcat |
19784541 |
T |
|
| Q |
97 |
tgttgcgatcaatctttcatgtagttcgccagttatgtgattatttattgtagtgtctctttatgcatgtcacaattcatagaataaata |
186 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19784540 |
tgttgcgatcaacctttcatgtagttcgtcagttatgtgattatttattgtagtgtctctttatgcatctcacaattcatagaataaata |
19784451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 178 - 221
Target Start/End: Complemental strand, 19784270 - 19784227
Alignment:
| Q |
178 |
gaataaatacatcattctcactatatatgaccaaatatgtgcat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19784270 |
gaataaatacatcattctcactatatatgaccaaatatgtgcat |
19784227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University