View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_low_58 (Length: 221)
Name: NF10151_low_58
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 19061348 - 19061513
Alignment:
| Q |
18 |
caaaactgttgtatttcattcatattcgtcttctctaatgttttctttgctttaaagtatttttaagtttaattcgccctcattagtt---atcattatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
19061348 |
caaaactgttgtatttcattcatattcgtcttctctaatgttttctttgctttaaagtatttttaagtttaattcgcccccattagttatcatcattatt |
19061447 |
T |
 |
| Q |
115 |
gttgttaaacaatgagatcaatatttttgagatcgattcattgaatatgtgaaaaatcgaagatgg |
180 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19061448 |
gttgttaaacaatgagatcaacatttttgagattgattcattgaatatgtgaaaaatcgaagatgg |
19061513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University