View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_low_59 (Length: 203)
Name: NF10151_low_59
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 190
Target Start/End: Complemental strand, 24066936 - 24066768
Alignment:
| Q |
22 |
cagctgcaacaagagcttcatctgtgtaatgaagtttataatgcgactcatatgttccgcggaggcctttaagaatttctatggtttcttcaacagatgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24066936 |
cagctgcaacaagagcttcatctgtgtaatgaagtttataatgcgactcatatgttccgcggaggcctttaagaatttctatggtttcttcaacagatgg |
24066837 |
T |
|
| Q |
122 |
ttcaaccactttaactggttgaaataatctttttaaggttgtatcattttccatgtgcattctgtgctc |
190 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24066836 |
ttcaaccactttaactggttgaaatattctttttaaggttgtatcattttccatgtgcattctgtgctc |
24066768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University