View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_high_24 (Length: 242)
Name: NF10153_high_24
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10153_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 53088824 - 53088996
Alignment:
| Q |
1 |
ctcaaccaattcgaccagcccggtcccggtccggtctagttttttaaacaatgcatggaacatccacaatatgcaagtatccatactctgctactctact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53088824 |
ctcaaccaattcgaccagcccggtcccggtccggtctagttttttaaacaatgcatggaacatccacaatatgcaagtatccatactctgctactctact |
53088923 |
T |
 |
| Q |
101 |
agtcgtcaactcacaaagttcaactacattttacacaatattattagaggcagttagatacatatgacacacg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53088924 |
agtcgtcaactcacaaagttcaactacattttacacaatattattagaggcagttagatacatatgacacacg |
53088996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 29 - 164
Target Start/End: Original strand, 14333554 - 14333689
Alignment:
| Q |
29 |
gtccggtctagttttttaaacaatgcatggaacatccacaatatgcaagtatccatactctgctactctactagtcgtcaactcacaaagttcaactaca |
128 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
14333554 |
gtccggtttagttctttaaacaatgcatggaacatccacaatatgcaagtatctatacactgctactctactagtcgtcacttcacaaagttcaactaaa |
14333653 |
T |
 |
| Q |
129 |
ttttacacaatattattagaggcagttagatacata |
164 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |
|
|
| T |
14333654 |
ttttacacaatattattagcgacagttagatacata |
14333689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University