View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_high_26 (Length: 242)
Name: NF10153_high_26
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10153_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 14 - 136
Target Start/End: Complemental strand, 30507656 - 30507534
Alignment:
| Q |
14 |
agataatagatatacttgaaattaaatatgatttatgagtcctccattgtgtcatgagattccctgcaccgattgacttatgcatttgctcattcgtgac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
30507656 |
agataatagatatacttgaaattaaatatgatttatgagtcctccattgtgtcacgagattccctgcaccggttgacttatgcatttgctcatttgtgac |
30507557 |
T |
 |
| Q |
114 |
atcggaagctatttgatcaagat |
136 |
Q |
| |
|
| ||||||||||||| ||||||| |
|
|
| T |
30507556 |
aacggaagctatttggtcaagat |
30507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 229
Target Start/End: Complemental strand, 30507516 - 30507431
Alignment:
| Q |
144 |
ttgcaaattttaatgtttaacaattnnnnnnnngcttgaatatagattgtgtgaacttgatcaaacgaccactgatgtcataattg |
229 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||| || |||||||||| ||||||||||||||| |||| |
|
|
| T |
30507516 |
ttgcaaattttaatgttttacaattaaataaaagcttgaatatagattgtttgttcttgatcaaatgaccactgatgtcatgattg |
30507431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University