View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10153_high_28 (Length: 238)

Name: NF10153_high_28
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10153_high_28
NF10153_high_28
[»] chr7 (1 HSPs)
chr7 (9-199)||(45779238-45779429)


Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 45779429 - 45779238
Alignment:
9 aagctgttgtggcgcgatagttgagagagatgccaatggacaatggccgtgagagagag--gagtcgggatggtggccgaggatgaaagacgtagccgag 106  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| |||||||||    
45779429 aagctgttgtggcgcg-tagttgagagagatgccaatggacaatggccgtgagagagagaggagtcgggatggtggccgaggatgaaagaggtagccgag 45779331  T
107 aaatgtgaaaaaacatatannnnnnnaaattgatatttttgaaacagtaaaatatgtttgtatcccaaaatttaaaagttttgttccatctct 199  Q
    |||||||||||||||||||       ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
45779330 aaatgtgaaaaaacatatatttttttaaattgatatttttgaaacagtaaaatatgtttgtgtcccaaaatttaaaagttttgttccatctct 45779238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University