View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_low_19 (Length: 313)
Name: NF10153_low_19
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10153_low_19 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 7 - 298
Target Start/End: Complemental strand, 230240 - 229946
Alignment:
| Q |
7 |
cgttggaccacaattaaacccattaaacgaagatcaactcccattcaatatgactgaactagactgcgatgtaaccacgatcaaaccaacccgtgaattg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
230240 |
cgttggaccacaattaaacccattaaaccaagatcaactctcattcaatatgactgaactagactgcgatgtaaccacgatcaaactaacccgtgaactg |
230141 |
T |
 |
| Q |
107 |
gccggttcttgattcaacaactagttgaatcagccaattcgg-accgatttc-at----tacttagaaagacacaaattattaataacggataaaccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
230140 |
gccggttcttgattcaacaactagttgaatcagccaattcggtcccgatttctatagcatacttaggaagacacaaattat---taacgaataaaccaaa |
230044 |
T |
 |
| Q |
201 |
ttctacttctcctacatcaagaattttgagtaccaaacaagtgatgagtacctggcctggagttaatggagttgcaaagctaatagcattatgagaag |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230043 |
ttctacttctcctacatcaagaattttgagtaccaaacaagtgatgagtacctggcctggagttaatggagttgcaaagctaatagcattatgagaag |
229946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University