View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_low_23 (Length: 283)
Name: NF10153_low_23
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10153_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 39088270 - 39088540
Alignment:
| Q |
18 |
gttccaagggttgggatcaaaggctatgagtggtggtcagaggctcttcatggagtttcaaatgtgggaccaggaactaagtttgctggccaattcccag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088270 |
gttccaagggttgggatcaaaggctatgagtggtggtcagaggctcttcatggagtttcaaatgtgggaccaggaactaagtttgctggccaattcccag |
39088369 |
T |
 |
| Q |
118 |
ctgccactagcttccctcaagtcatcactaccgttgcttcattcaatgcttcattgtgggaagcaattggacgggtcagctataacttttttaatgcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088370 |
ctgccactagcttccctcaagtcatcactaccgttgcttcattcaatgcttccttgtgggaagcaattggacgggtcagctataacttttttaatgcaaa |
39088469 |
T |
 |
| Q |
218 |
acactatactcttt-----tgtaagcaatactatgattttttcattcatctaaatctaatgtaagggtaat |
283 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088470 |
acactatactcttttttaatttaagcaatactatgattttttcattcatctaaatctaatgtaagggtaat |
39088540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 40 - 193
Target Start/End: Complemental strand, 44721058 - 44720905
Alignment:
| Q |
40 |
gctatgagtggtggtcagaggctcttcatggagtttcaaatgtgggaccaggaactaagtttgctggccaattcccagctgccactagcttccctcaagt |
139 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||| ||||| |||| |||| ||| ||||| ||||| ||||| || |||||||| |
|
|
| T |
44721058 |
gctatgagtggtggtcggaggcacttcatggtgtttcaaatgtgggtccaggtactagatttggtggtgtgttccctgctgctactagttttcctcaagt |
44720959 |
T |
 |
| Q |
140 |
catcactaccgttgcttcattcaatgcttcattgtgggaagcaattggacgggt |
193 |
Q |
| |
|
||||| |||| |||||| || |||||||| |||||||| || ||||||||||| |
|
|
| T |
44720958 |
tatcacaaccgctgcttcttttaatgcttctttgtgggaggctattggacgggt |
44720905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 37 - 164
Target Start/End: Original strand, 13297929 - 13298056
Alignment:
| Q |
37 |
aaggctatgagtggtggtcagaggctcttcatggagtttcaaatgtgggaccaggaactaagtttgctggccaattcccagctgccactagcttccctca |
136 |
Q |
| |
|
|||| |||||||||||||| || ||| | ||||| ||||| |||||||| ||||| ||||| |||| ||| ||| | || ||||||||||||||||| |
|
|
| T |
13297929 |
aaggttatgagtggtggtcggaagctttacatggtgtttctaatgtgggcccaggtactaaatttggtggggccttctccgccgccactagcttccctca |
13298028 |
T |
 |
| Q |
137 |
agtcatcactaccgttgcttcattcaat |
164 |
Q |
| |
|
||| ||||| |||| |||||| |||||| |
|
|
| T |
13298029 |
agttatcaccaccgctgcttctttcaat |
13298056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University