View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_low_25 (Length: 258)
Name: NF10153_low_25
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10153_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 22864670 - 22864913
Alignment:
Q |
1 |
gcagtgataatgttgccgttaattaataataattttacagtgtagatcataatttttataatatnnnnnnnnnnnnnttatatccataattcgtttatca |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
22864670 |
gcagtgataatgttgccgttaattaataataattttacagtgtagatcataatttttataataaaaaaaaaaaaaa--tatatccacaattcgtttatca |
22864767 |
T |
 |
Q |
101 |
ttatttcaaattacttatatcgtagaccaaactgtggatatttgatctcgattggcacatcttgtgctttcttaataatatgttaaattataaaataaaa |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||| ||||||||| |||||| | ||||| || ||||||| |||||||||||| |||||||||||||||||| |
|
|
T |
22864768 |
ttatttcaaattacttatatcgtagaacaaacggtggatatt-gatctcaaatggcatatattgtgctctcttaataatatattaaattataaaataaaa |
22864866 |
T |
 |
Q |
201 |
gtgctagtattattgtgacaaaaaagcaagaatgtgatgcatgtgat |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22864867 |
gtgctagtattattgtgacaaaaaagcaagaatgtgatgcatgtgat |
22864913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University