View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_low_32 (Length: 243)
Name: NF10153_low_32
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10153_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 233
Target Start/End: Complemental strand, 44546465 - 44546252
Alignment:
| Q |
20 |
ctgaagatgaagcagctgagattgtataatactggatggaccatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546465 |
ctgaagatgaagcagctgagattgtataatactggatggaccatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtga |
44546366 |
T |
|
| Q |
120 |
a---gaaggttgtagagctttttcttttgagtattagggtacctaatcttgtgaagaagaaggaaatcatataaatctttttcatgatcccatgttctct |
216 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546365 |
agaagaaggtcgtagagctttttcttttgagtattagggtccctaatcttgt---gaagaaggaaatcatataaatctttttcatgatcccatgttctct |
44546269 |
T |
|
| Q |
217 |
ttctagggttcttctct |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44546268 |
ttctagggttcttctct |
44546252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University