View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_low_37 (Length: 238)
Name: NF10153_low_37
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10153_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 45779429 - 45779238
Alignment:
| Q |
9 |
aagctgttgtggcgcgatagttgagagagatgccaatggacaatggccgtgagagagag--gagtcgggatggtggccgaggatgaaagacgtagccgag |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45779429 |
aagctgttgtggcgcg-tagttgagagagatgccaatggacaatggccgtgagagagagaggagtcgggatggtggccgaggatgaaagaggtagccgag |
45779331 |
T |
|
| Q |
107 |
aaatgtgaaaaaacatatannnnnnnaaattgatatttttgaaacagtaaaatatgtttgtatcccaaaatttaaaagttttgttccatctct |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45779330 |
aaatgtgaaaaaacatatatttttttaaattgatatttttgaaacagtaaaatatgtttgtgtcccaaaatttaaaagttttgttccatctct |
45779238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University