View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10153_low_39 (Length: 219)
Name: NF10153_low_39
Description: NF10153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10153_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 52104938 - 52105146
Alignment:
Q |
1 |
tcccataaggtgtgttcatgatatattttgttttcttcattgcattcacactatgttctttatacataaacagctcatgtgaactgtttcagctaaactt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52104938 |
tcccataaggtgtgttcatgatatattttgttttcttcattgcattcacactatgttctttatacataaacagctcatgtgaactgtttcagctaaactt |
52105037 |
T |
 |
Q |
101 |
gccacattcaaatcatttgcttcggaatactacaacttcatctactaacaatgtctcttgtgcaatggaaacaacttccagtacagaaagtaagagctta |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52105038 |
gccacattcaaatcatttgcttcggaatactacaacttcatcttctaacaatgtctcttgtgcaatggaaacaacttccagtacagaaagtaagagctta |
52105137 |
T |
 |
Q |
201 |
atctgtgct |
209 |
Q |
|
|
||||||||| |
|
|
T |
52105138 |
atctgtgct |
52105146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University