View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_high_12 (Length: 236)
Name: NF10154_high_12
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10154_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 22 - 220
Target Start/End: Original strand, 39581908 - 39582105
Alignment:
Q |
22 |
tgtaatgatgagaattgaagaaaattactaaaatgatacagtgttgaattgccattggggagagagttcaaaattgtgtttgtttgaatgatcttttaat |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
T |
39581908 |
tgtaatgatgagaattgaagaaaattactaaaatgatacagtgttgaattgccgttggggagagaattcaaa-ttgtgtttgtttgaatgatcttttaat |
39582006 |
T |
 |
Q |
122 |
ctttgattgcaaatcttagacgtagggaatgggagaagtgaaggagaaccaatgaagaagacttagataagttgaggaagacttgaggtgcggactgtg |
220 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39582007 |
ctttgattgcaaatcttagaagtagggaatgggagaagtgaaggagaaccaatgaagaagacttagataagttgaggaagacttgaggtgcggactgtg |
39582105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 118
Target Start/End: Original strand, 39581194 - 39581296
Alignment:
Q |
19 |
aattgtaatgatgagaattgaagaaaa----ttactaaaatgatacagtgttgaattgccattggggagagagttcaaaattgtgtttgtttgaatgatc |
114 |
Q |
|
|
||||||||||||||||||||||||| | ||| || || |||| | |||||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
T |
39581194 |
aattgtaatgatgagaattgaagaagaaaagttagtagaacgatagactgttgaattgccat-ggggagagagttgataattgtgtttgtttgaatgatt |
39581292 |
T |
 |
Q |
115 |
tttt |
118 |
Q |
|
|
|||| |
|
|
T |
39581293 |
tttt |
39581296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 104
Target Start/End: Original strand, 39544833 - 39544887
Alignment:
Q |
50 |
taaaatgatacagtgttgaattgccattggggagagagttcaaaattgtgtttgt |
104 |
Q |
|
|
|||||||||| |||||||| ||||||||| ||||||||| | |||||||||||| |
|
|
T |
39544833 |
taaaatgatagtgtgttgaactgccattggagagagagttgataattgtgtttgt |
39544887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 39521997 - 39522034
Alignment:
Q |
8 |
cgagtgagatgaattgtaatgatgagaattgaagaaaa |
45 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||| |
|
|
T |
39521997 |
cgagtgaggggaattgtaatgatgagaattgaagaaaa |
39522034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 108
Target Start/End: Original strand, 39525547 - 39525598
Alignment:
Q |
54 |
atgatacagtgttgaattgccattggggagagagttcaaaattgtgtttgtttga |
108 |
Q |
|
|
|||||| |||||||||||||||| |||||||||| |||||| ||||||||||| |
|
|
T |
39525547 |
atgatagagtgttgaattgccat---ggagagagttgaaaattatgtttgtttga |
39525598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University