View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_high_14 (Length: 227)
Name: NF10154_high_14
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 42759130 - 42758954
Alignment:
| Q |
1 |
actaaaaacaccaataactgcctctttacaacactctattaaagaaatgttgcgtttatatgaaacactgctaatctggaaatatagaaggttattttta |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42759130 |
actaaaaacaacaataactgcctctttacaacactctattaaagaaatgttgcgtttatatgaaacactgctaatctgaaaatatagaaggttattttta |
42759031 |
T |
 |
| Q |
101 |
aaaggatacagggtaacttactaaaatgc-ttttttactacaagtgctttgtgcaactctaataattattcagtttt |
176 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42759030 |
aaaggatacagggtaacttactgaaatactttttttactacagtagctttgtgcaactctaataattattcagtttt |
42758954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University