View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_high_6 (Length: 261)
Name: NF10154_high_6
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 31869639 - 31869866
Alignment:
| Q |
15 |
cacagaccagcaagatatttgagtgttaataattctcaaccacaaacatcgacttcaaaaaataannnnnnncgatgttttaaatggcagtgtaaaggtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31869639 |
cacagaccagcaagatatttgagtgttaataattctcaaccacaaacatcgacttcaaaaaataatttttttcgatgttttaaatggcagtgtaaaggtt |
31869738 |
T |
 |
| Q |
115 |
acactacatttgccagcagacctttagattgcatcatgtaatgcagctgcaaaggttttaaacagaagtctgtgactgagatctgggcagcaacatcagg |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31869739 |
acactacatttgccagcagacttttagattgcatcatgtaatgcagctgcaaaggttttaaacagaagtttgtgactgagatctgggcagcaacatcagg |
31869838 |
T |
 |
| Q |
215 |
gtttttgttgttactgtgactataattg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31869839 |
gtttttgttgttactgtgactataattg |
31869866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University