View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_low_1 (Length: 642)
Name: NF10154_low_1
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 21144863 - 21144596
Alignment:
| Q |
1 |
tccacacctcctcaaccacctctttgatttgcctattatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144863 |
tccacacctcctcaaccacctctttgatttgcctattatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcc |
21144764 |
T |
 |
| Q |
101 |
tcatcaaaatccaagaactcaccaaattggtctccaatctgcttgaaagcctcttcatcccagacatgaactggtaaacttaggattttaatccaaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144763 |
tcatcaaaatccaagaactcaccaaattggtctccaatctgcttgaaagcctcttcatcccagacatgaactggtaaacttaggattttaatccaaacag |
21144664 |
T |
 |
| Q |
201 |
ttattttgctggccactaagcttggattccattccttcatctccctaaaatgagaatcccaccaaaat |
268 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144663 |
ttcttttgctggccactaagcttggattccattccttcatctccctaaaatgagaatcccaccaaaat |
21144596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University