View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_low_19 (Length: 250)
Name: NF10154_low_19
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 166 - 232
Target Start/End: Original strand, 7112823 - 7112889
Alignment:
| Q |
166 |
cagattatagcagaaaatcaaaaagttgaaacaggatttttgggaaacaaaataaacacacatgatt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7112823 |
cagattatagcagaaaatcaaaaagttgaaacaggatttttgggaaacaaaatcaacacacatgatt |
7112889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 164
Target Start/End: Original strand, 7112798 - 7112843
Alignment:
| Q |
119 |
taactgaataagatgcttgatctatcagattatagcagaaaatcaa |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7112798 |
taactgaataagatgcttgatctatcagattatagcagaaaatcaa |
7112843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 7112680 - 7112710
Alignment:
| Q |
1 |
tacactttgaatttactcaacaaataatcct |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7112680 |
tacactttgaatttactcaacaaataatcct |
7112710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University