View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10154_low_24 (Length: 237)

Name: NF10154_low_24
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10154_low_24
NF10154_low_24
[»] chr5 (1 HSPs)
chr5 (19-66)||(1402796-1402843)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 1402843 - 1402796
Alignment:
19 cataggtaagctgttaaatttaattcacaccccaaatacatgcctcca 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
1402843 cataggtaagctgttaaatttaattcacaccccaaatacatgcctcca 1402796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University