View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_low_30 (Length: 217)
Name: NF10154_low_30
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 3 - 200
Target Start/End: Original strand, 33309685 - 33309885
Alignment:
| Q |
3 |
tctgcatgcaaataggattgatgagatattgcacaattgtgaagcaaaatttgaaatcaaatccatgaagggggatagatttcttgtccccccttcttta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33309685 |
tctgcatgcaaataggattgatgagatattgcacaattgtgaagcaaaatttgaaatcaaatccatgaagggggatagatttcttgtccccccttcttta |
33309784 |
T |
|
| Q |
103 |
caaagagaaatatcaaaatgggaagaaagggattttgtcaaaaagtgtagaacataagaaaatcca---aggtcaatgttgtagcatggttgttaagaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33309785 |
caaagagaaatatcaaaatgggaagaaagggattttgtcaaaaagtgtagaacataagaaaagccaaccaggtcaatgttgtagcatggttgttaagaat |
33309884 |
T |
|
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
33309885 |
t |
33309885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University