View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_low_34 (Length: 205)
Name: NF10154_low_34
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 35230908 - 35230733
Alignment:
| Q |
14 |
cataggtgtcagacacggacacggtgtggagatcctaactaggccataaaacgcatcagaaacaatgtcagaaaaaacatgagttaagttgattgattca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35230908 |
cataggtgtcagacacggacacggtgtggagatcctaactaggccataaaacgcatcagaaacaatgtcagaaaaaacatgagttaagtttattgattca |
35230809 |
T |
 |
| Q |
114 |
gggtttagggtttaacaaacattgcaggtgatagtgtatttagggtataagtttttgtgagtaaaatgagctatat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35230808 |
gggtttagggtttaacaaacattgcaggtgatagtgtatttagggtataagtttttgtgagtaaaatgagctatat |
35230733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University