View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10154_low_6 (Length: 402)
Name: NF10154_low_6
Description: NF10154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10154_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 112 - 343
Target Start/End: Complemental strand, 20480077 - 20479846
Alignment:
| Q |
112 |
gaaaatgctatttattatgaaacatccgttaacgaaatcgaagaaaacatttaatttagcggttgcatccactacctcatgttttctgtcaagtaacaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
20480077 |
gaaaatgctatttattatgaaacatccgttaacgaaatcgaagaaaacgtttaatttagcggttgtatccactacctcatgttttccgtcaagtaacaag |
20479978 |
T |
|
| Q |
212 |
ttaaaattttgctgacctttttataaaaaatgaacggcaataacattcttgtctttcgtatgagggtgatcggtaccaaatagcacctctcaaaatttat |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479977 |
ttaaaattttgctgacctttttataaaaaatgaacggaaataacattcttgtctttcgtatgagggtgatcggtaccaaatagcacctctcaaaatttat |
20479878 |
T |
|
| Q |
312 |
taaccccacttattcgagctgaagacataacc |
343 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
20479877 |
taaccccacttattcgagctgaagacgtaacc |
20479846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University