View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10155_high_5 (Length: 250)
Name: NF10155_high_5
Description: NF10155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10155_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 19475278 - 19475462
Alignment:
| Q |
1 |
aaataatagtatggttagaatagtgatttatgttaaagaagggtattatgatgaaaatgttgaaataccaagttataaaactaacattgtgatgcttggt |
100 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19475278 |
aaataatagtttggttaggatagttatttatgttaaagaagggtattatgatgaaaatgttgaaataccaagttataaaactaacattgtgatgcttggt |
19475377 |
T |
 |
| Q |
101 |
gatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttcagatctgcaactttaggtgaag |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19475378 |
gatggaagtgattctactgtcatcactggtaacagaagtgttgttgatggatggaccactttcagatctgcaactttaggtgaag |
19475462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 29 - 181
Target Start/End: Original strand, 51547414 - 51547566
Alignment:
| Q |
29 |
tatgttaaagaagggtattatgatgaaaatgttgaaataccaagttataaaactaacattgtgatgcttggtgatggaagtgattctactgtcatcactg |
128 |
Q |
| |
|
||||| ||||||||| ||||| |||||||||||||| |||| ||||||| || ||||| | |||||||||||||| ||| |||||||| |||| |
|
|
| T |
51547414 |
tatgtaaaagaagggatatatgaggaaaatgttgaaatttcaagcaataaaaccaatattgttctacttggtgatggaagggatcaaactgtcattactg |
51547513 |
T |
 |
| Q |
129 |
gtaacagaagtgttgttgatggatggaccactttcagatctgcaactttaggt |
181 |
Q |
| |
|
| || ||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51547514 |
gcaatagaagtgatgttgatggatggaccaccttcagatctgcaactttaggt |
51547566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University