View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10155_high_6 (Length: 242)
Name: NF10155_high_6
Description: NF10155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10155_high_6 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 19474977 - 19475201
Alignment:
Q |
18 |
cagccctaaccaacaaaaacacatgtttagatggtcttgattctgcttctggtacatataaaccaattcttgtggattctattatcaacacttacaaaca |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19474977 |
cagccctaaccaacaaaaacacatgtttagatggtcttgattctgcttctggtacatataaaccaattcttgtggattctattatcaacacttacaaaca |
19475076 |
T |
 |
Q |
118 |
tgtaagtaactctctttctatgctttctaatcatgcacctgagccttcaaatcaaaagggtcacaacaaaaatttggtttctccaaaatggttatcaaaa |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19475077 |
tgtaagtaactctctttctatgctttctaatcatgcacctgagccttcaaatcaaaagggtcacaacaaaaatttggtttctccaaaatggttatcaaaa |
19475176 |
T |
 |
Q |
218 |
aggttagatattgatgaatatgatc |
242 |
Q |
|
|
||||||||| ||||||||||||||| |
|
|
T |
19475177 |
aggttagattttgatgaatatgatc |
19475201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University