View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10155_low_5 (Length: 311)
Name: NF10155_low_5
Description: NF10155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10155_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 300
Target Start/End: Original strand, 55273212 - 55273493
Alignment:
| Q |
20 |
cattggtacccattgtcatcccttggttcatctttttcctcattttacctctgtatttcgatgatgaccatgccaattaccacctgcaaatcattcaaat |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55273212 |
cattggtacccattgtcatctcttggttcatctttttcctcattttacctctgtatttcgatgatgaccatgccaattaccacctgcaaatcattcaaat |
55273311 |
T |
 |
| Q |
120 |
gattgctgatttttcggctatgannnnnnnnnnnnnnnnatgaggattacatgtttcaatgtttcaagtaataaaattgtgttaatgaaaaccaacaaaa |
219 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55273312 |
gattgctgatttttcggctatgatttccttttcttttttatgaggattacatgtttcaatatttcaagtaataaaattgtgttaatgaaaaccaacaaaa |
55273411 |
T |
 |
| Q |
220 |
attaaagctttttatgaattattattgaggttcggtgatc-acaacaacagagagttgttattgggttcattattttttctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55273412 |
attaaagctttttatgaattattattgaggttcggtgatcaacaacaacagagagttgttattgggttcattattttttctt |
55273493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University