View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_high_13 (Length: 295)
Name: NF10156_high_13
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10156_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 6 - 281
Target Start/End: Complemental strand, 41023016 - 41022741
Alignment:
Q |
6 |
agcttcttggagtttcggcttctactccgtttcggcagtacacgcgaattactgtttgtgttgagaatacgttacaggcgaatgcgttgaatgcggggaa |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
41023016 |
agcttcttggagtttcggcttctactccgtttcggcagtacacgcggattactgtttgtgttgagaatacgttgcaggcgaatgcgttgaatgcggggaa |
41022917 |
T |
 |
Q |
106 |
tccgattttgaagacttatgatttggttgctgttatgccgctgaatcagaatgcgttcgatgttgcttgtgagcgaatggcggttagttcaatttaatcc |
205 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
41022916 |
tccgattttgaagacttatgatttggttgctgttatgccgctgaatcagaatgcgttcgatgttgcttgtgagagaatggcggttagttcaatttaatcc |
41022817 |
T |
 |
Q |
206 |
ttattgattgattctgaagaaaaaacattgagatttttggtatatgatttgagaagtgaaaatatataatgtagct |
281 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41022816 |
ttattgattgtttctgaagaaaaaacattgagatttttggtatatgatttgagaagtgaaaatatataatgtagct |
41022741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University