View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_high_16 (Length: 273)
Name: NF10156_high_16
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10156_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 34351478 - 34351231
Alignment:
| Q |
19 |
gacacagcatcaagaaatatgagatttaatcaaagtggaggaacatcacaatcttcttcatctaccataaccaacaacatagttgattttgcttggcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34351478 |
gacacagcatcaagaaatatgagatttaatcaaagtggaggaacatcacaatcttcttcatctaccataaccaacaacatagttgattttgcttggcaaa |
34351379 |
T |
 |
| Q |
119 |
attcagatatggtggaaataaaaccaagatcttccatggaaaattcttctgttgtttttcatgataatcagaaacttcaacaacctcaagattcttctac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34351378 |
attcagatatggtggaaataaaaccaagatcttccatggaaaattcttctgttgtttttcatgataatcagaaacttcaacaacctcaagattcttctac |
34351279 |
T |
 |
| Q |
219 |
ttcatctgaccctaacttgcatatgatgggtttaggtctttcttctca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34351278 |
ttcatctgaccctaacttgcatatgatgggtttaggtctttcttctca |
34351231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 232 - 266
Target Start/End: Complemental strand, 23875527 - 23875493
Alignment:
| Q |
232 |
aacttgcatatgatgggtttaggtctttcttctca |
266 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23875527 |
aacttgcatatgatgggtttaggactttcttctca |
23875493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University