View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_high_8 (Length: 347)
Name: NF10156_high_8
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10156_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 169 - 335
Target Start/End: Complemental strand, 45330022 - 45329856
Alignment:
| Q |
169 |
gtgtcaatattttatttattgtacaacaaatagagtagtagtactactctgaaatttttgtttgtacctcaacttgagacaacttgatatctatatttgt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45330022 |
gtgtcaatattttatttattgtacaacaaatagagtagcagtgctactctgaaatttttgtttgtacctcaacttgagacaatttgatatctatatttgt |
45329923 |
T |
|
| Q |
269 |
accttaaggaaatttgccatttggcagaaaaccaatattgnnnnnnngtatacttagtagatgccta |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45329922 |
accttaaggaaatttgccatttggcagaaaaccaatattgtttttttgtatacttagtagatgccta |
45329856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University