View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_low_14 (Length: 298)
Name: NF10156_low_14
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10156_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 6476299 - 6476565
Alignment:
| Q |
18 |
agaagattctggaatttttcgagaatcggtggagattgttcgaatttgaagaaactcgccggcgcgggaaagtcgccggaggagatttctgatatctctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476299 |
agaagattctggaatttttcgagaattggtggagattgttcgaatttgaagaaactcgccgacgcgggaaagtcgccggaggagatttctgatatctctg |
6476398 |
T |
 |
| Q |
118 |
agtcttgcgctcagatgatttttcagttgcataatcatgttgaggtaactttgaaatgaaatttaccgcgnnnnnnnactagttaccgcgaataataatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6476399 |
agtcttgcgctcagatgatttttcagttgcataatcatgttgaggtaactttgaaatgaaatttaccgcgtttttttactagttaccgcgaataataatt |
6476498 |
T |
 |
| Q |
218 |
aatctcggttaaatatgaaacgctttatctttatcgtattcgtaactgaagaattactgttaaccttcttctc |
290 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6476499 |
aatcacggttaaatatgaaacg------ctttatcgtattcgtaactgaagaattactgttaaccttcttctc |
6476565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University