View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_low_16 (Length: 279)
Name: NF10156_low_16
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10156_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 279
Target Start/End: Original strand, 32527978 - 32528246
Alignment:
| Q |
11 |
cataggcgctttcgagccaaacaaaaccataactaagaatcacggaagtgaaaaggtcttgatacataaaatgaccgataaccaatcgcatatccaaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32527978 |
cataggcgctttcgagccaaacaaaaccataactaagaatcacggaagcgaaaaggtcttgatacataaaatgaccgataaccaatcacatatccaaaat |
32528077 |
T |
 |
| Q |
111 |
gagggatcgacaaatctgagcaccataaatagtaaaacgacaacacatgaaagaacaccatcaaatattaacagacacaaaaccaccattgtggttggca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528078 |
gagggatcgacaaatctgagcaccataaatagtaaaacgacgacacatgaaagaacaccatcaaatattaacagacacaaaaccaccattgtggttggca |
32528177 |
T |
 |
| Q |
211 |
ataaaccaaacgccttgaaagttgtagatttggaaagaaccagaaatcagaggcaagaaatacaaccac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32528178 |
ataaaccaaacgccttgaaagttgtagatctggaaagaaccagaaatcagaggcaagaaatacagccac |
32528246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University