View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_low_24 (Length: 240)
Name: NF10156_low_24
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10156_low_24 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 29942644 - 29942867
Alignment:
Q |
17 |
actgcccccatatatggaattgttatcttgggnnnnnnnnnnnnnactcaacgtttctctttgttcttcttgttttgacgatagtaattgcttgagtaca |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
29942644 |
actgcccccatatatggaattgttatcttgggtttttacttttttactcaacgtttctctttgttcttcttgtttggacgatagtaattgcttgagtaca |
29942743 |
T |
 |
Q |
117 |
aacaagtttttaaacttaggtcaatttgacagtccatactgcatcatgttttctgtgacttttgcatgcattcatagttcatttatatcaaatttattat |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29942744 |
aacaagtttttaaacttaggtcaatttgacagtccatactgcatcatgttttctgtgacttttgcatgcattcatagttcatttatatcaaatttattat |
29942843 |
T |
 |
Q |
217 |
gttctttgtgtggttttatttagt |
240 |
Q |
|
|
||||||||| |||||||||||||| |
|
|
T |
29942844 |
gttctttgtttggttttatttagt |
29942867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University