View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_low_27 (Length: 227)
Name: NF10156_low_27
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10156_low_27 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 2 - 227
Target Start/End: Complemental strand, 29943226 - 29943001
Alignment:
Q |
2 |
gtatctaaaatttgaactctgacccttacacatattaattactattcgagatgtcatctttttaaataaattttaattactcggatgattaatttatgtg |
101 |
Q |
|
|
|||||| |||||||||||| || ||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||||| || |
|
|
T |
29943226 |
gtatctgaaatttgaactccgatccttacatatattaattacaattcgagatgtcatttttttaaataaattttaattactcgaatgattaatttatatg |
29943127 |
T |
 |
Q |
102 |
attgcgcgcgacatatattggtattatttacaacaagaatatgtattattaacaagaatattcttgaagtacaatgtttaaacactaggcaccaaacacg |
201 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29943126 |
gtagcgcgcgacatatattggtattatttacaacaagaatatgtattattaacaagaatattcttgaagtacaatgtttaaacactaggcaccaaacacg |
29943027 |
T |
 |
Q |
202 |
atcatgtttattaacacaaccggacc |
227 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
29943026 |
atcatgtttattaacacaaccggacc |
29943001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University