View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10156_low_29 (Length: 201)
Name: NF10156_low_29
Description: NF10156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10156_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 572590 - 572760
Alignment:
| Q |
18 |
agacaagaaaaagagtaacatgtgttttttaattacctcgtaagatggaacatgggaagaaactttggctttgtttttgtgtgactttgaggttgttgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
572590 |
agacaagaaaaagagtaacatgtgttttttaattacctcgtaagatggaacatgggaagaaactttggctttgtttttgtgtgactttgaggttgttgat |
572689 |
T |
 |
| Q |
118 |
gatgatgttttgagaagcctagccaaccttttttgtctactgctccagaaattttttacatcattgtctgt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
572690 |
gatgatgttttgagaagcctagccaaccttttttgtctactgctccagaaattttttacatcattgtctgt |
572760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University