View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10157_low_12 (Length: 237)
Name: NF10157_low_12
Description: NF10157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10157_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 53006223 - 53006428
Alignment:
| Q |
16 |
catttacaaggcacacaatgcattcaaataaactttgcttatttctcctggaaaggaaatttttcgacatcttactgtagtcatttcataactgatctct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53006223 |
catttacaaggcacacaatgcattcaaataaactttgcctatttctcctggaaaggaaatttttcgacatcttattgtagtcatttcataactgatctct |
53006322 |
T |
 |
| Q |
116 |
agttagttattattcaaatcataattctatgtttccctatgtagcggcaactatccaaaatgattcagatattcgtttcgaacacctattcgaaaactaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
53006323 |
agttagttattattcaaatcataattctatgtttccctatgtagcggcgactatccaaaatgattcagatattcgttttgaacacctatttgaaaactaa |
53006422 |
T |
 |
| Q |
216 |
tctgtg |
221 |
Q |
| |
|
|||||| |
|
|
| T |
53006423 |
tctgtg |
53006428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University