View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10158_low_5 (Length: 280)
Name: NF10158_low_5
Description: NF10158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10158_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 33 - 265
Target Start/End: Complemental strand, 33167789 - 33167559
Alignment:
| Q |
33 |
agctcgtgagaaaatgacacttatcgattatttt-gggtcatataagcatataagttataaggctatatatcaactataagctaacttgtgcttgtcnnn |
131 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33167789 |
agctcgtgagaaaatgacatttattgattttttttgggtcatataagcatataagttacaaggctatatatcaactatcagctaacttgtgcttgtc-aa |
33167691 |
T |
|
| Q |
132 |
nnnnnnnttaattaactttatttttggatnnnnnnncaaataaccctattaaagataaattgtgtttggttgtttggtcatacnnnnnnnnnntgatagt |
231 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33167690 |
aaaaatattaattaactttatttttggat-aaaaaacatataaccctattaaagataaattgtgtttggttgtttggtcatac-aaaaaaaaatgatagt |
33167593 |
T |
|
| Q |
232 |
agtttttaaatatggatacacatagagatatata |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33167592 |
agtttttaaatatggatacacatagagatatata |
33167559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University