View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10158_low_8 (Length: 238)
Name: NF10158_low_8
Description: NF10158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10158_low_8 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 38800494 - 38800716
Alignment:
Q |
16 |
aattatgtaagtatcaatgcccatagtgaaagatattctgctaccatacattagcatacatttctgaagattaactcctattgctttaaaatcattatac |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38800494 |
aattatgtaagtatcaatgcccatagtgaaagatattctgctaccatacattagcatacatttctgaagattaactcctattgctttaaaatcattatac |
38800593 |
T |
 |
Q |
116 |
ctgaagctgaggttgactgatatcaaatgcaggctgcaaaaacaaattatgcaaatcagtttttgtatctttgatttgcgtaaactaaaataatggctaa |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38800594 |
ctgaagctgaggttgactgatatcaaatgcaggctgcaaaaacaaattatgcaaattagtttttgtatctttgatttgcgtaaactaaaataatggctaa |
38800693 |
T |
 |
Q |
216 |
cggatataagatttatcattacc |
238 |
Q |
|
|
|| |||||||||||||||||||| |
|
|
T |
38800694 |
cgaatataagatttatcattacc |
38800716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University