View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_high_24 (Length: 233)
Name: NF10159_high_24
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 102 - 216
Target Start/End: Original strand, 27563906 - 27564020
Alignment:
| Q |
102 |
cttaagatcaatcacatgcttcttcaacagtataaacaacatttgcttaagctcttccatatagttaactatcttcttcatctttaacatgctgaaataa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27563906 |
cttaagatcaatcacatgcttcttcaacaatataagcaacatttgcttaagctcttccatatagttaactatcttcttcatctttaacatgctgaaataa |
27564005 |
T |
 |
| Q |
202 |
aggagacgagcccct |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27564006 |
aggagacgagcccct |
27564020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 27563341 - 27563446
Alignment:
| Q |
1 |
tttgtgtttagatttcgagtgtgtatgtt-gaatctcttagtttcttaccatattgcatgtttcagggagagaagacatcaagttgagttgcgtgtgatg |
99 |
Q |
| |
|
||||| ||||||| || |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
27563341 |
tttgtatttagatgtctagtgtgtatgtttgaatcttctagtttcttaccatattgcatgtttcagggagagaagatatcaacttgagttatgtgtgatg |
27563440 |
T |
 |
| Q |
100 |
atctta |
105 |
Q |
| |
|
|||||| |
|
|
| T |
27563441 |
atctta |
27563446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University