View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_high_27 (Length: 221)
Name: NF10159_high_27
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_high_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 962398 - 962617
Alignment:
| Q |
1 |
tgaaagttcatagaagctaatcactaccatcaagaacaaatccatatatcataaatattaaacacattattaatcttttttatcttttgctaactactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
962398 |
tgaaagttcatagaagctaatcactaccatcaagaacaaatcca-atatcataaatattaaacacattattaatcttttttatcttttgctaactaccat |
962496 |
T |
 |
| Q |
101 |
tctaaagatttatattatacacaatgtctttgaagatagcagccgaaaattggcaaaaaccatcatcaaagaaggttgaagaggcagtgatagagataag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
962497 |
tctaaagatttatattatacacaatgtctttgaagatagcagctgaaaattggcaaaaaccatcatcaaagaaggttgaagaggcagtgatagtgataag |
962596 |
T |
 |
| Q |
201 |
aagttatgatgaagagaaaca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
962597 |
aagttatgatgaagagaaaca |
962617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University