View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_low_26 (Length: 301)
Name: NF10159_low_26
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 17 - 288
Target Start/End: Complemental strand, 41842020 - 41841749
Alignment:
| Q |
17 |
agatcttataccattcctcatttcctccttatggctccagtagcttcgtatcggcagattctatggggtggaattccatggtttatgtatgtaatgtaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41842020 |
agatcttataccattcctcatttcctccttatggctccagtagcttcgtatcggcagattctatggggtggaattccaacgtttatgtatgtaatgtaat |
41841921 |
T |
|
| Q |
117 |
caaaaactaaaacaagcacacggtcagaatgaaatgaagtattatgcattgctgtaactgtatatgtatcatacatatatatgcataacattttgtagga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
41841920 |
caaaaactaaaacaagcacacggtcagaatgaaatgaagtattatgcattgctgtaactgtatatgtatcatacatacatatacataacattttgtagga |
41841821 |
T |
|
| Q |
217 |
tttcagggaaagttggttttagtttatgctaactgtatatgtattgccgtctacatgcacgctttttagcct |
288 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41841820 |
tttcagggaaagttgattttagtttatgctaactgtatatgtattgccgtctacatgcacactttttagcct |
41841749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 41841549 - 41841508
Alignment:
| Q |
223 |
ggaaagttggttttagtttatgctaactgtatatgtattgcc |
264 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41841549 |
ggaaagttgattttagtttatgctaactgtatatgtattgcc |
41841508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 288
Target Start/End: Complemental strand, 3461833 - 3461787
Alignment:
| Q |
242 |
atgctaactgtatatgtattgccgtctacatgcacgctttttagcct |
288 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
3461833 |
atgcaaactgtatatgtattgctgtctacatacacactttttagcct |
3461787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University