View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_low_35 (Length: 266)
Name: NF10159_low_35
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 26534955 - 26534867
Alignment:
| Q |
23 |
attagttggtcggtttgttagttgattaagcttcatatatgctatagagctcttgtattctatttcttgcatcttttatcaatatcaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
26534955 |
attagttggtcggtttgttagttgattaagcttcatatatgctatagagctcttgtattttatttcttgtatcttttatcaatatcaaa |
26534867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 195 - 257
Target Start/End: Complemental strand, 26534793 - 26534731
Alignment:
| Q |
195 |
agatcgttcatcttacaccaacctttctgatgccaccatatactaccccacacacatacattt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26534793 |
agatcgttcatcttacaccaacctttctgatgccaccatatactacccctcacacatacattt |
26534731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University