View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10159_low_37 (Length: 251)

Name: NF10159_low_37
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10159_low_37
NF10159_low_37
[»] chr1 (1 HSPs)
chr1 (1-243)||(26534342-26534591)
[»] chr8 (2 HSPs)
chr8 (123-235)||(25827623-25827734)
chr8 (74-235)||(25471859-25472019)
[»] chr5 (1 HSPs)
chr5 (137-178)||(16267422-16267463)
[»] chr7 (3 HSPs)
chr7 (138-174)||(20244606-20244642)
chr7 (138-174)||(20248644-20248680)
chr7 (138-174)||(20264978-20265014)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 26534591 - 26534342
Alignment:
1 cccgcgcatccgttcctcgaacaacacccacagcagcttccgtgggaca-------acatcagcggctgctgatactcacattggtgctttgacttcttc 93  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||        ||||||||||||||| |||||||| |||||||||||||||||||    
26534591 cccgcgcatccattcctcgaacaacacccacagcagcttccgtgggactttcctctacatcagcggctgcttatactcacgttggtgctttgacttcttc 26534492  T
94 cccagatccttctgggtggtaacttccccagcgtgggcatcttaaatgcaacattgatgcctctttttcaagtcagttgaatagatcaggtattggcata 193  Q
    ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26534491 cccagatccttctaggtggtaacttcctcagcgtgggcatcttaaatgcaacattgatgcctctttctcaagtcagttgaatagatcaggtattggcata 26534392  T
194 tgtttatgcgacgaagatggggaattttgtgccgccaaaaaccctttgct 243  Q
    ||||||| |||||||||||| |||||||||||||||||||||||| ||||    
26534391 tgtttatccgacgaagatggagaattttgtgccgccaaaaaccctatgct 26534342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 235
Target Start/End: Complemental strand, 25827734 - 25827623
Alignment:
123 agcgtgggcatcttaaatgcaacattgatgcctctttttcaagtcagttgaatagatcaggtattggcatatgtttatgcgacgaagatggggaattttg 222  Q
    ||||||||| ||| ||||  ||||||||||||||||| ||| ||||||| |||| | |||||||| | ||||||||| ||||||||||||||| ||||||    
25827734 agcgtgggcgtctcaaatctaacattgatgcctctttatcacgtcagttaaataaaacaggtattagaatatgtttacgcgacgaagatgggg-attttg 25827636  T
223 tgccgccaaaaac 235  Q
    ||| | |||||||    
25827635 tgctggcaaaaac 25827623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 235
Target Start/End: Complemental strand, 25472019 - 25471859
Alignment:
74 attggtgctttgacttcttccccagatccttctgggtggtaacttccccagcgtgggcatcttaaatgcaacattgatgcctctttttcaagtcagttga 173  Q
    ||||||||||  ||||||| || || | ||||| | ||| || ||||  ||||||||| ||| ||||| |||||||||| |||||| ||| || |||| |    
25472019 attggtgcttcaacttctttcctagcttcttctcgatggcaatttccttagcgtgggcgtctcaaatgtaacattgatgtctctttctcacgttagttaa 25471920  T
174 atagatcaggtattggcatatgtttatgcgacgaagatggggaattttgtgccgccaaaaac 235  Q
    ||| | || ||||| | || |||| ||| || |||||||||| ||||||||| | |||||||    
25471919 ataaaacatgtattagaatgtgttcatgtgatgaagatgggg-attttgtgctggcaaaaac 25471859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 16267422 - 16267463
Alignment:
137 aaatgcaacattgatgcctctttttcaagtcagttgaataga 178  Q
    |||||||||||||||||||| || |||||| |||||||||||    
16267422 aaatgcaacattgatgcctccttctcaagtgagttgaataga 16267463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 174
Target Start/End: Original strand, 20244606 - 20244642
Alignment:
138 aatgcaacattgatgcctctttttcaagtcagttgaa 174  Q
    ||||||||||||||||| |||||||| ||||||||||    
20244606 aatgcaacattgatgccactttttcaggtcagttgaa 20244642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 174
Target Start/End: Original strand, 20248644 - 20248680
Alignment:
138 aatgcaacattgatgcctctttttcaagtcagttgaa 174  Q
    ||||||||||||||||| |||||||| ||||||||||    
20248644 aatgcaacattgatgccactttttcaggtcagttgaa 20248680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 174
Target Start/End: Original strand, 20264978 - 20265014
Alignment:
138 aatgcaacattgatgcctctttttcaagtcagttgaa 174  Q
    ||||||||||||||||| |||||||| ||||||||||    
20264978 aatgcaacattgatgccgctttttcaggtcagttgaa 20265014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University