View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_low_45 (Length: 245)
Name: NF10159_low_45
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 8181567 - 8181348
Alignment:
| Q |
9 |
agcacagaataacagcccatatgtaaaaccaactccaacaccttttgcaaaaccactcttctttccaagcttcaaagccttatcaagcgactttgagtat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8181567 |
agcacagaataacagcccatatgtaaaaccgactccaacaccttttgcaaaaccactcttctttccaagcttcaaagccttatcaagcgactttgagtat |
8181468 |
T |
 |
| Q |
109 |
gaaccaacagctttttcttctcctgcaaatgagtaaactgtacgcactcgagaaattacttcttcagcaactttttctgcttcagcataagctgctttgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8181467 |
gaaccaacagctttttcttctcctgcaaatgagtaaactgtacgcactcgagaaattacttcttcagcaactttttctgcttcagcataagctgctttgc |
8181368 |
T |
 |
| Q |
209 |
ctttttccgataaagtagat |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8181367 |
ctttttccgataaagtagat |
8181348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University