View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_low_55 (Length: 230)
Name: NF10159_low_55
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 43458422 - 43458209
Alignment:
| Q |
1 |
acaagtaaatataaaactaaataacttcaactatggtttaaagtttagctagaattatannnnnnnngtttgtttggtacggctcatagtttactgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43458422 |
acaagtaaatataaaactaaataacttcaactacggtttaaagtttagctagaattatatttttttcgtttgtttggtacggctcatagtttactgataa |
43458323 |
T |
|
| Q |
101 |
gtaggcaggtcgctcgagcagggcgagtatttaaacacaagttgtattgcagtcgaagacgtatgcacaatagaccaaactctgtggtcaaatatcatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458322 |
gtaggcaggtcgctcgagcagggcgagtatttaaacacaagttgtattgcagtcgaagacgtatgcacaatagaccaaactctgtggtcaaatatcatgt |
43458223 |
T |
|
| Q |
201 |
tttctctgtttacg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43458222 |
tttctctgtttacg |
43458209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 113
Target Start/End: Complemental strand, 4557178 - 4557146
Alignment:
| Q |
81 |
ggctcatagtttactgataagtaggcaggtcgc |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4557178 |
ggctcatagtttattgataagtaggcaggtcgc |
4557146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 115
Target Start/End: Complemental strand, 34372583 - 34372551
Alignment:
| Q |
83 |
ctcatagtttactgataagtaggcaggtcgctc |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
34372583 |
ctcatagtttactgataagttggcaggtcgctc |
34372551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University