View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10159_low_60 (Length: 219)
Name: NF10159_low_60
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10159_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 520264 - 520084
Alignment:
| Q |
18 |
acacagtctttagttcattaaaatgaagagcagatagatgggatccaggaaggaaaaagagaagttcaatctgagagtgttttgttttatatgattaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
520264 |
acacagtctttagttcattaaaatgaagagcagat----gggatccaggaaggaaaaagagaagctcaatctgagagtgttttgttttatatgattaatt |
520169 |
T |
|
| Q |
118 |
-aatttagttgaaaggtgcagtgcatgtgtgtggagagaggacattaattaaaatattgaatatgcaagtatagatcctactcacctttg |
206 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
520168 |
taatttagttgaaaggtgca-----tatatgtggagagaggacattaattaaaatattgaatatgcaagtatagatcctactcacttttg |
520084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University