View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10159_low_60 (Length: 219)

Name: NF10159_low_60
Description: NF10159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10159_low_60
NF10159_low_60
[»] chr2 (1 HSPs)
chr2 (18-206)||(520084-520264)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 520264 - 520084
Alignment:
18 acacagtctttagttcattaaaatgaagagcagatagatgggatccaggaaggaaaaagagaagttcaatctgagagtgttttgttttatatgattaatt 117  Q
    |||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
520264 acacagtctttagttcattaaaatgaagagcagat----gggatccaggaaggaaaaagagaagctcaatctgagagtgttttgttttatatgattaatt 520169  T
118 -aatttagttgaaaggtgcagtgcatgtgtgtggagagaggacattaattaaaatattgaatatgcaagtatagatcctactcacctttg 206  Q
     |||||||||||||||||||     | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
520168 taatttagttgaaaggtgca-----tatatgtggagagaggacattaattaaaatattgaatatgcaagtatagatcctactcacttttg 520084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University