View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1015_low_13 (Length: 250)
Name: NF1015_low_13
Description: NF1015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1015_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 148 - 240
Target Start/End: Complemental strand, 42631626 - 42631534
Alignment:
| Q |
148 |
gttatatggtgaatatggcaagaaatggaactaagaaaattgtgagtggttatgaaagcgccaaaaccagaacatgacagacaccctcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631626 |
gttatatggtgaatatggcaagaaatggaactaagaaaattgtgagtggttatgaaagcgccaaaaccagaacatgacagacaccctcctatg |
42631534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 42631775 - 42631704
Alignment:
| Q |
1 |
aatgaagaaattatggtttaacgtttgaaggataaggtttaacagtttccgacgcagtttaaggtggcgagg |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631775 |
aatgaagaaattatggtttaacgtttgaaggaaaaggtttaacagtttccgacgcagtttaaggtggcgagg |
42631704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University