View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1015_low_7 (Length: 315)
Name: NF1015_low_7
Description: NF1015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1015_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 43062333 - 43062191
Alignment:
Q |
1 |
tctcgaattgcaggtttttcaatttagagtcaatttcgtgaaagatgcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataag |
100 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43062333 |
tctcgaattgcaggtttttcaattgagagtcaatttcgtgaaagatgcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgccgataag |
43062234 |
T |
 |
Q |
101 |
attttctctatgtgctctgaccttggtggtttcttcctcaagg |
143 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43062233 |
attttctctatgtgctctgaccttggtggtttcttcctcaagg |
43062191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 208 - 305
Target Start/End: Complemental strand, 43062126 - 43062029
Alignment:
Q |
208 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaaaaggctggttacgctctgtg |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43062126 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaaaaggctggttacgctctgtg |
43062029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University