View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10160_high_7 (Length: 288)

Name: NF10160_high_7
Description: NF10160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10160_high_7
NF10160_high_7
[»] chr3 (1 HSPs)
chr3 (213-269)||(55161036-55161091)


Alignment Details
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 269
Target Start/End: Original strand, 55161036 - 55161091
Alignment:
213 ttattattaataacagtcacgtgagatttagttacacaaatattgtagcatgtgaag 269  Q
    ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||    
55161036 ttattattaataacagtcacgtgagatttggttacac-aatattgtagcatgtgaag 55161091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University