View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10160_high_9 (Length: 233)
Name: NF10160_high_9
Description: NF10160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10160_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 33238942 - 33238732
Alignment:
| Q |
17 |
accttgtggatcttgtttgagacaaagcaaactcttcacaatattttgaatctcacagtctataccatcttggtgtttcttgagtcttttgctttctatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238942 |
accttgtggatcttgtttgagacaaagcaaactcttcacaatatcttgaatctcacagtctataccatcttggtgtttcttgagtcttttgctttctatt |
33238843 |
T |
 |
| Q |
117 |
tcgatccaaaaacgaggaacaatcttagggtcatcttttcccaagtgatagtgttctattatagcatctgctcttaagatagtttcatgcctttttgttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238842 |
tcgatccaaaaacgaggaacaatcttagggtcatcttttcccaagtgatagtgttctattatagcatctgctcttaagatagtttcatgcctttttgttt |
33238743 |
T |
 |
| Q |
217 |
tctcctatgct |
227 |
Q |
| |
|
||||| ||||| |
|
|
| T |
33238742 |
tctccaatgct |
33238732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University