View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10160_low_14 (Length: 285)
Name: NF10160_low_14
Description: NF10160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10160_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 4417339 - 4417592
Alignment:
| Q |
10 |
gcaaaggtcacgatgctgctcggttccactgcatcgatcatgctcatgggtaagcatagtgatctaaatatgatataccttcatgtagaatttattttcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417339 |
gcaaaggtcacgatgctgctcggttccactgcatcgatcatgctcatgggtaagcatagtgatctaaatatgatataccttcatgtagaatttattttcc |
4417438 |
T |
 |
| Q |
110 |
acaacattgatcatcttgtggtttctactcaagacaaactaaaggaatcaaaataaaaatctggcaaaaatgtagagactaattgtttatttcaacatat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417439 |
tcaacattgatcatcttgtggtttctactcaagacaaactaaaggaatcaaaataaaaatctggcaaaaatgtagagactaattgtttatttcaacatat |
4417538 |
T |
 |
| Q |
210 |
attttacattttgcacaaagtaattatcagtaattttttgcatcagattgaact |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417539 |
attttacattttgcacaaagtaattatcagtaattttttgcatcagattgaact |
4417592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University