View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_high_21 (Length: 242)
Name: NF10161_high_21
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 43547540 - 43547317
Alignment:
| Q |
1 |
ctttccattggtaaaagtagtgataggttgacttgcatcacaattaaagtaatcaaacttctccacagtaagaactgaatcattcttgtactcaaaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43547540 |
ctttccattggtaaaagtagtgataggttgacttgcatcacaattaaagtaatcaaacttctccacagtaagaactgaatcattctcgtactcaaaaact |
43547441 |
T |
|
| Q |
101 |
gcataaacaaaaatgtgaatcataacttgggctgcaagaaaaagaaatgaagtgaataatgaattaaaaagtattatataccgagagaatctccgatttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43547440 |
gcataaacaaaaatgtgaatcataacttgggctgcaagaaaaagaaatgaagtgaataatgaattaaaaagcattatataccgagagaatctccgatttg |
43547341 |
T |
|
| Q |
201 |
gaaacggtttctttcagcccattg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43547340 |
gaaacggtttctttcagcccattg |
43547317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University